PCR Genotyping Primer Pairs

The following primer pairs will amplify sequences present as a single copy in the mouse genome with the Universal Genotyping Protocol. Note the two sets of Fabpi primers are used as internal controls. The Fabpi primers amplify sequences from the endogenous mouse intestinal fatty acid binding protein gene. Two different sized control amplimers are available so that the control band won’t interfere with the experimental band of any size.

b-Galactosidase (LacZ)

389 base pair amplimer


These primers amplify the Clontech enhanced CFP.
408 base pair amplimer


These primers amplify the Clontech enhanced CFP.
271 base pair amplimer

diphtheria toxin

170 base pair amplimer


200 base pair amplimer


These primers are used as internal controls, and are included in reactions with other primers. They amplify a sequence from the intestinal fatty acid binding protein gene. There are two sets of Fabpi primers one for a 200 base pair amplimer and one for a 500 base pair amplimer.
194 base pair amplimer


These primers are used as internal controls, and are included in reactions with other primers. They amplify a sequence from the intestinal fatty acid binding protein gene. There are two sets of Fabpi primers one for a 200 base pair amplimer and one for a 500 base pair amplimer.
466 base pair amplimer

flp recombinase

741 base pair amplimer


These primers amplify the Clontech enhanced GFP, BFP, and YFP.
280 base pair amplimer

human growth hormone (complete)

These primers are near the 5’ end of the entire hGH gene.
360 base pair amplimer

human growth hormone (transcriptional stop)

These primers amplify the hGH sequence surrounding the polyA signal, which is commonly used in transgenes as a transcriptional stop sequence.
5’ primer - act cca gtg ccc acc agc ctt gtc cta ata
3’ primer - att gca gtg agc caa gat tgt gcc act gca
200 base pair amplimer

luciferase (click-beetle)

gtc gat gtg gtc ggc gat gaa tct ttg agc
tag ctc tcg ttg act gga gcc acg atc ata
200 base pair amplimer

luciferase (firefly)

323 base pair amplimer

neomycin phosphotransferase

380 base pair amplimer

SRY (male-specific)

273 base pair amplimer

tTA (tet-on)

5’ primer - agcttggtgtagagcagcctacactgtatt
3’ primer - gctccattgcgatgacttagtaaagcacat
193 base pair amplimer

© 2019 Washington University in St. Louis