PCR Genotyping Primer Pairs

The following primer pairs will amplify sequences present as a single copy in the mouse genome with the Universal Genotyping Protocol. Note the two sets of Fabpi primers are used as internal controls. The Fabpi primers amplify sequences from the endogenous mouse intestinal fatty acid binding protein gene. Two different sized control amplimers are available so that the control band won’t interfere with the experimental band of any size.

b-Galactosidase (LacZ)
5’ primer - GTT GCA GTG CAC GGC AGA TAC ACT TGC TGA
3’ primer - GCC ACT GGT GTG GGC CAT AAT TCA ATT CGC
389 base pair amplimer

cre-recombinase
5’ primer - GCA TTA CCG GTC GAT GCA ACG AGT GAT GAG
3’ primer - GAG TGA ACG AAC CTG GTC GAA ATC AGT GCG
408 base pair amplimer

CFP
These primers amplify the Clontech enhanced CFP.
5’ primer - GCA GCA CGA CTT CTT CAA GTC CGC CAT GCC
3’ primer - GTG GCG GAT CTT GAA GTT GGC CTT GAT GCC
271 base pair amplimer

diphtheria toxin
5’ primer - GTG GTC AAA GTG ACG TAT CCA GGA CTG ACG
3’ primer - AGA ACT ACA CGC GAA GCA CCA TCC CCG AAC
170 base pair amplimer

dsRED
5’ primer - GTA ATG CAG AAG AAG ACT ATG GGC TGG GAG
3’ primer - ATG TCC AGC TTG GAG TCC ACG TAG TAG TAG
200 base pair amplimer

Fabpi-200
These primers are used as internal controls, and are included in reactions with other primers. They amplify a sequence from the intestinal fatty acid binding protein gene. There are two sets of Fabpi primers one for a 200 base pair amplimer and one for a 500 base pair amplimer.
5’ primer - TGG ACA GGA CTG GAC CTC TGC TTT CCT AGA
3. primer - TAG AGC TTT GCC ACA TCA CAG GTC ATT CAG
194 base pair amplimer

Fabpi-500
These primers are used as internal controls, and are included in reactions with other primers. They amplify a sequence from the intestinal fatty acid binding protein gene. There are two sets of Fabpi primers one for a 200 base pair amplimer and one for a 500 base pair amplimer.
5’ primer - CCT CCG GAG AGC AGC GAT TAA AAG TGT CAG
3. primer - TAG AGC TTT GCC ACA TCA CAG GTC ATT CAG
466 base pair amplimer

flp recombinase
5’ primer - GTC CAC TCC CAG GTC CAA CTG CAG CCC AAG
3. primer - CGC TAA AGA AGT ATA TGT GCC TAC TAA CGC
741 base pair amplimer

GFP/BFP/YFP
These primers amplify the Clontech enhanced GFP, BFP, and YFP.
5’ primer - GCA CGA CTT CTT CAA GTC CGC CAT GCC
3’ primer - GCG GAT CTT GAA GTT CAC CTT GAT GCC
280 base pair amplimer

human growth hormone (complete)
These primers are near the 5’ end of the entire hGH gene.
5’ primer - CTG CAC CAG CTG GCG TTT GAC ACC TAC CAG
3’ primer - TTT CTG TTG TGT TTC CTC CCT GTT GGA GGG
360 base pair amplimer

human growth hormone (transcriptional stop)
These primers amplify the hGH sequence surrounding the polyA signal, which is commonly used in transgenes as a transcriptional stop sequence.
5’ primer - act cca gtg ccc acc agc ctt gtc cta ata
3’ primer - att gca gtg agc caa gat tgt gcc act gca
200 base pair amplimer

luciferase (click-beetle)
gtc gat gtg gtc ggc gat gaa tct ttg agc
tag ctc tcg ttg act gga gcc acg atc ata
200 base pair amplimer

luciferase (firefly)
5’ primer - AGA CGC CAA AAA CAT AAA GAA AGG CCC GGC
3’ primer - TAT AAA TGT CGT TCG CGG GCG CAA CTG CAA
323 base pair amplimer

neomycin phosphotransferase
5’ primer - TGC TCC TGC CGA GAA AGT ATC CAT CAT GGC
3’ primer - CGC CAA GCT CTT CAG CAA TAT CAC GGG TAG
380 base pair amplimer

SRY (male-specific)
SRY F - TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
SRY R - CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
273 base pair amplimer

tTA (tet-on)
5’ primer - agcttggtgtagagcagcctacactgtatt
3’ primer - gctccattgcgatgacttagtaaagcacat
193 base pair amplimer

Login  | © 2014 Washington University in St. Louis