Washington University >> School of Medicine >> Mouse Genetics Core >> Protocols >> PCR Genotyping Primer Pairs
logo
Skip Navigation Links
Project Tracking
Staff
  Search
 
PCR Genotyping Primer Pairs

The following primer pairs will amplify sequences present as a single copy in the mouse genome with the Universal Genotyping Protocol.  Note the two sets of Fabpi primers are used as internal controls.  The Fabpi primers amplify sequences from the endogenous mouse intestinal fatty acid binding protein gene.  Two different sized control amplimers are available so that the control band won’t interfere with the experimental band of any size.

b-Galactosidase (LacZ)

5’ primer          GTT GCA GTG CAC GGC AGA TAC ACT TGC TGA

3’ primer          GCC ACT GGT GTG GGC CAT AAT TCA ATT CGC

389 base pair amplimer

cre-recombinase

5’ primer          GCA TTA CCG GTC GAT GCA ACG AGT GAT GAG

3’ primer          GAG TGA ACG AAC CTG GTC GAA ATC AGT GCG

408 base pair amplimer

CFP

These primers amplify the Clontech enhanced CFP.

5’ primer          GCA GCA CGA CTT CTT CAA GTC CGC CAT GCC

3’ primer          GTG GCG GAT CTT GAA GTT GGC CTT GAT GCC

271 base pair amplimer

diphtheria toxin

5’ primer          GTG GTC AAA GTG ACG TAT CCA GGA CTG ACG

3’ primer          AGA ACT ACA CGC GAA GCA CCA TCC CCG AAC

170 base pair amplimer

dsRED

5’ primer          GTA ATG CAG AAG AAG ACT ATG GGC TGG GAG

3’ primer          ATG TCC AGC TTG GAG TCC ACG TAG TAG TAG

200 base pair amplimer

Fabpi-200

These primers are used as internal controls, and are included in reactions with other primers.  They amplify a sequence from the intestinal fatty acid binding protein gene.  There are two sets of Fabpi primers one for a 200 base pair amplimer and one for a 500 base pair amplimer.

5’ primer          TGG ACA GGA CTG GAC CTC TGC TTT CCT AGA

3. primer          TAG AGC TTT GCC ACA TCA CAG GTC ATT CAG

194 base pair amplimer

Fabpi-500

These primers are used as internal controls, and are included in reactions with other primers.  They amplify a sequence from the intestinal fatty acid binding protein gene.  There are two sets of Fabpi primers one for a 200 base pair amplimer and one for a 500 base pair amplimer.

5’ primer          CCT CCG GAG AGC AGC GAT TAA AAG TGT CAG

3. primer          TAG AGC TTT GCC ACA TCA CAG GTC ATT CAG

466 base pair amplimer

flp recombinase

5’ primer          GTC CAC TCC CAG GTC CAA CTG CAG CCC AAG

3. primer          CGC TAA AGA AGT ATA TGT GCC TAC TAA CGC

741 base pair amplimer

GFP/BFP/YFP

These primers amplify the Clontech enhanced GFP, BFP, and YFP.

5’ primer          GCA CGA CTT CTT CAA GTC CGC CAT GCC

3’ primer          GCG GAT CTT GAA GTT CAC CTT GAT GCC

280 base pair amplimer

human growth hormone (complete)

These primers are near the 5’ end of the entire hGH gene.

5’ primer          CTG CAC CAG CTG GCG TTT GAC ACC TAC CAG

3’ primer          TTT CTG TTG TGT TTC CTC CCT GTT GGA GGG

360 base pair amplimer

human growth hormone (transcriptional stop)

These primers amplify the hGH sequence surrounding the polyA signal, which is commonly used in transgenes as a transcriptional stop sequence.

5’ primer          act cca gtg ccc acc agc ctt gtc cta ata

3’ primer          att gca gtg agc caa gat tgt gcc act gca

200 base pair amplimer

luciferase (click-beetle)

gtc gat gtg gtc ggc gat gaa tct ttg agc

tag ctc tcg ttg act gga gcc acg atc ata

200 base pair amplimer

luciferase (firefly)

5’ primer          AGA CGC CAA AAA CAT AAA GAA AGG CCC GGC

3’ primer          TAT AAA TGT CGT TCG CGG GCG CAA CTG CAA

323 base pair amplimer

neomycin phosphotransferase

5’ primer          TGC TCC TGC CGA GAA AGT ATC CAT CAT GGC

3’ primer          CGC CAA GCT CTT CAG CAA TAT CAC GGG TAG

380 base pair amplimer

SRY (male-specific)

SRY F :  TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA

SRY R :  CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA

273 base pair amplimer

tTA (tet-on)

5’ primer          agcttggtgtagagcagcctacactgtatt

3’ primer          gctccattgcgatgacttagtaaagcacat

193 base pair amplimer

 

 
dna
 
| Terms Of Use | Privacy Statement | Copyright 2014 by Washington University in St. Louis, School of Medicine | |